puc19 backbone (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
97
Structured Review
New England Biolabs
puc19 backbone
Puc19 Backbone, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1404 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/puc19+backbone/pUC19+Vector/pmc12881585-322-9-17
Average 97 stars, based on 1404 article reviews
Puc19 Backbone, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1404 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/puc19+backbone/pUC19+Vector/pmc12881585-322-9-17
Average 97 stars, based on 1404 article reviews
puc19 backbone - by Bioz Stars,
2026-09
97/100 stars
Images
Related Articles
Clone Assay:Article Title: Compositions comprising a variant polypeptide and uses thereof Article Snippet: The variant polypeptides were cloned into a pcDNA3.1 backbone (Invitrogen®). .. The RNA guides (crRNAs) of Table 7 were cloned into a Article Title: Multifunctional nanoparticle platform for targeted delivery and vaccines Article Snippet: .. The expression cassette from the pY71 vector was cloned into the Article Title: Compositions comprising a variant polypeptide and uses thereof Article Snippet: Variants of SEQ ID NO: 3 were cloned into a pcda3.1 backbone (Invitrogen®). .. RNA guides were cloned into a Article Title: The genetic architecture of protein interaction affinity and specificity Article Snippet: .. For the prey intermediate plasmid, a gene fragment was ordered from Twist carrying an SP1 Illumina primer binding site, a 24 bp placeholder barcode sequence (AAGTTCGTTGCATCACCTAGCCAA; prey barcode), a 188 bp random spacer sequence, an SP2 Illumina primer binding site, the CYC promoter, a 3 x Flag-tag fused to a DHFR C-terminal half (from here on referred to as FR-tag), a Linker sequence (Linker L4, GASGSAAGGSGSAGSGASAS), the JUN bZIP wt sequence (consisting of the wt DNA-binding domain (DBD) and the five heptads of the wt zipper domain), and Linker L3 was cloned into the Article Title: The genetic architecture of protein interaction affinity and specificity. Article Snippet: .. For the prey intermediate plasmid, a gene fragment was ordered from Twist carrying an SP1 Illumina primer binding site, a 24 bp placeholder barcode sequence (AAGTTCGTTGCATCACCTAGCCAA; prey barcode), a 188 bp random spacer sequence, an SP2 Illumina primer binding site, the CYC promoter, a 3 x Flag-tag fused to a DHFR C-terminal half (from here on referred to as FR-tag), a Linker sequence (Linker L4, GASGSAAGGSGSAGSGASAS), the JUN bZIP wt sequence (consisting of the wt DNA-binding domain (DBD) and the five heptads of the wt zipper domain), and Linker L3 was cloned into the Article Title: Gene editing systems comprising an RNA guide targeting lactate dehydrogenase a (LDHA) and uses thereof Article Snippet: The Cas12i2 variants of SEQ ID NO: 1168 and SEQ ID NO: 1171 were individually cloned into a pcda3.1 backbone (Invitrogen). .. Nucleic acids encoding RNA guides E3T1, E3T3, E5T1, E5T9, and E5T10 (Table 7) were cloned into a Expressing:Article Title: Multifunctional nanoparticle platform for targeted delivery and vaccines Article Snippet: .. The expression cassette from the pY71 vector was cloned into the Polymerase Chain Reaction:Article Title: ATM Inhibition Enhances Knock-in Efficiency by Suppressing AAV-Induced Activation of Apoptotic Pathways. Article Snippet: .. These five fragments were assembled into the PCR-amplified linearized Article Title: ATM Inhibition Enhances Knock-in Efficiency by Suppressing AAV-Induced Activation of Apoptotic Pathways Article Snippet: .. These five fragments were assembled into the PCR-amplified linearized Cloning:Article Title: ATM Inhibition Enhances Knock-in Efficiency by Suppressing AAV-Induced Activation of Apoptotic Pathways. Article Snippet: .. These five fragments were assembled into the PCR-amplified linearized Article Title: ATM Inhibition Enhances Knock-in Efficiency by Suppressing AAV-Induced Activation of Apoptotic Pathways Article Snippet: .. These five fragments were assembled into the PCR-amplified linearized Synthesized:Article Title: ATM Inhibition Enhances Knock-in Efficiency by Suppressing AAV-Induced Activation of Apoptotic Pathways. Article Snippet: .. These five fragments were assembled into the PCR-amplified linearized Article Title: ATM Inhibition Enhances Knock-in Efficiency by Suppressing AAV-Induced Activation of Apoptotic Pathways Article Snippet: .. These five fragments were assembled into the PCR-amplified linearized Plasmid Preparation:Article Title: ATM Inhibition Enhances Knock-in Efficiency by Suppressing AAV-Induced Activation of Apoptotic Pathways. Article Snippet: .. These five fragments were assembled into the PCR-amplified linearized Article Title: ATM Inhibition Enhances Knock-in Efficiency by Suppressing AAV-Induced Activation of Apoptotic Pathways Article Snippet: .. These five fragments were assembled into the PCR-amplified linearized Article Title: The genetic architecture of protein interaction affinity and specificity Article Snippet: .. For the prey intermediate plasmid, a gene fragment was ordered from Twist carrying an SP1 Illumina primer binding site, a 24 bp placeholder barcode sequence (AAGTTCGTTGCATCACCTAGCCAA; prey barcode), a 188 bp random spacer sequence, an SP2 Illumina primer binding site, the CYC promoter, a 3 x Flag-tag fused to a DHFR C-terminal half (from here on referred to as FR-tag), a Linker sequence (Linker L4, GASGSAAGGSGSAGSGASAS), the JUN bZIP wt sequence (consisting of the wt DNA-binding domain (DBD) and the five heptads of the wt zipper domain), and Linker L3 was cloned into the Article Title: The genetic architecture of protein interaction affinity and specificity. Article Snippet: .. For the prey intermediate plasmid, a gene fragment was ordered from Twist carrying an SP1 Illumina primer binding site, a 24 bp placeholder barcode sequence (AAGTTCGTTGCATCACCTAGCCAA; prey barcode), a 188 bp random spacer sequence, an SP2 Illumina primer binding site, the CYC promoter, a 3 x Flag-tag fused to a DHFR C-terminal half (from here on referred to as FR-tag), a Linker sequence (Linker L4, GASGSAAGGSGSAGSGASAS), the JUN bZIP wt sequence (consisting of the wt DNA-binding domain (DBD) and the five heptads of the wt zipper domain), and Linker L3 was cloned into the Binding Assay:Article Title: The genetic architecture of protein interaction affinity and specificity Article Snippet: .. For the prey intermediate plasmid, a gene fragment was ordered from Twist carrying an SP1 Illumina primer binding site, a 24 bp placeholder barcode sequence (AAGTTCGTTGCATCACCTAGCCAA; prey barcode), a 188 bp random spacer sequence, an SP2 Illumina primer binding site, the CYC promoter, a 3 x Flag-tag fused to a DHFR C-terminal half (from here on referred to as FR-tag), a Linker sequence (Linker L4, GASGSAAGGSGSAGSGASAS), the JUN bZIP wt sequence (consisting of the wt DNA-binding domain (DBD) and the five heptads of the wt zipper domain), and Linker L3 was cloned into the Article Title: The genetic architecture of protein interaction affinity and specificity. Article Snippet: .. For the prey intermediate plasmid, a gene fragment was ordered from Twist carrying an SP1 Illumina primer binding site, a 24 bp placeholder barcode sequence (AAGTTCGTTGCATCACCTAGCCAA; prey barcode), a 188 bp random spacer sequence, an SP2 Illumina primer binding site, the CYC promoter, a 3 x Flag-tag fused to a DHFR C-terminal half (from here on referred to as FR-tag), a Linker sequence (Linker L4, GASGSAAGGSGSAGSGASAS), the JUN bZIP wt sequence (consisting of the wt DNA-binding domain (DBD) and the five heptads of the wt zipper domain), and Linker L3 was cloned into the Sequencing:Article Title: The genetic architecture of protein interaction affinity and specificity Article Snippet: .. For the prey intermediate plasmid, a gene fragment was ordered from Twist carrying an SP1 Illumina primer binding site, a 24 bp placeholder barcode sequence (AAGTTCGTTGCATCACCTAGCCAA; prey barcode), a 188 bp random spacer sequence, an SP2 Illumina primer binding site, the CYC promoter, a 3 x Flag-tag fused to a DHFR C-terminal half (from here on referred to as FR-tag), a Linker sequence (Linker L4, GASGSAAGGSGSAGSGASAS), the JUN bZIP wt sequence (consisting of the wt DNA-binding domain (DBD) and the five heptads of the wt zipper domain), and Linker L3 was cloned into the Article Title: The genetic architecture of protein interaction affinity and specificity. Article Snippet: .. For the prey intermediate plasmid, a gene fragment was ordered from Twist carrying an SP1 Illumina primer binding site, a 24 bp placeholder barcode sequence (AAGTTCGTTGCATCACCTAGCCAA; prey barcode), a 188 bp random spacer sequence, an SP2 Illumina primer binding site, the CYC promoter, a 3 x Flag-tag fused to a DHFR C-terminal half (from here on referred to as FR-tag), a Linker sequence (Linker L4, GASGSAAGGSGSAGSGASAS), the JUN bZIP wt sequence (consisting of the wt DNA-binding domain (DBD) and the five heptads of the wt zipper domain), and Linker L3 was cloned into the |